Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101004 |
| Name | oriT_pEC156_2  |
| Organism | Escherichia coli |
| Sequence Completeness | intact |
| NCBI accession of oriT (coordinates [strand]) | AF158026 ( 3867..3960 [+], 94 nt) |
| oriT length | 94 nt |
| IRs (inverted repeats) | 15..22, 25..31 (GTCGGGTG..CCCTGAC) |
| Location of nic site | 83..84 |
| Conserved sequence flanking the nic site |
_ |
| Note |
oriT sequence
Download Length: 94 nt
>oriT_pEC156_2
CGTCAGTACCGGGTGTCGGGTGGACCCTGACCAGGTGGTAATTGTAAGACGTTGCGGGCGACGGTATTACAATTGCACATCCTGTCCTGTTTTT
CGTCAGTACCGGGTGTCGGGTGGACCCTGACCAGGTGGTAATTGTAAGACGTTGCGGGCGACGGTATTACAATTGCACATCCTGTCCTGTTTTT
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Olesia Werbowy et al. (2016) Plasmid pEC156, a Naturally Occurring Escherichia coli Genetic Element That Carries Genes of the EcoVIII Restriction-Modification System, Is Mobilizable among Enterobacteria. PloS one. 11(2):e0148355. [PMID:26848973]
Host bacterium
| ID | 1463 | GenBank | AF158026 |
| Plasmid name | pEC156 | Incompatibility group | ColRNAI |
| Plasmid size | 4312 bp | Coordinate of oriT [Strand] | 4098..4312 [+]; 3867..3960 [+] |
| Host baterium | Escherichia coli |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |