Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   101003
Name   oriT_pEC156_1 experimental
Organism   Escherichia coli
Sequence Completeness      intact
NCBI accession of oriT (coordinates [strand])   AF158026 (_)
oriT length   284 nt
IRs (inverted repeats)    
Location of nic site      21..22
Conserved sequence flanking the
  nic site  
 
 _
Note   

  oriT sequence  


Download         Length: 284 nt

>oriT_pEC156_1
GTTCTCATGCCTGAAATGCCCACACCCCACGCAAAAACAATTTTTTGCTGATTTTTCTTTATAAATAGAGAGTTATGACAAATTAGTTCTTCTTGCTCTCTTTGTGATATTTAAAAAAGCGGTGTCGGCGCGGTGTTGTAGCTGCGCCAACACCGCTTTTTAGGGGTGGTACTGACTATTTTCATAAAAAACATCATTTTATATTAGGGGTGCTGCTAGCGGCGCGGTGTGTTTTTTTACAGGACGCCCCTGGGGGCGCTGCTAGGGGTGTCTGTTCAGATATG

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Olesia Werbowy et al. (2016) Plasmid pEC156, a Naturally Occurring Escherichia coli Genetic Element That Carries Genes of the EcoVIII Restriction-Modification System, Is Mobilizable among Enterobacteria. PloS one. 11(2):e0148355. [PMID:26848973]


Host bacterium


ID   1463 GenBank   AF158026
Plasmid name   pEC156 Incompatibility group   ColRNAI
Plasmid size   4312 bp Coordinate of oriT [Strand]   4098..4312 [+]; 3867..3960 [+]
Host baterium   Escherichia coli

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -