Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101002 |
| Name | oriT_pCERC7  |
| Organism | Escherichia coli strain 11.1-R1 |
| Sequence Completeness | intact |
| NCBI accession of oriT (coordinates [strand]) | KX356458 (2074..2148 [+], 75 nt) |
| oriT length | 75 nt |
| IRs (inverted repeats) | IR1: 1..8, 12..19 (GTCGGGGC..GCCCTGAC) IR2: 30..43, 46..65 (GTAATAGCGTGCAT..ATGCGCGGTATAACAATTGC) |
| Location of nic site | 73..74 |
| Conserved sequence flanking the nic site |
ATCCTG|T |
| Note |
oriT sequence
Download Length: 75 nt
>oriT_pCERC7
GTCGGGGCGAAGCCCTGACCAGGGTAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTGCACATCCTGTC
GTCGGGGCGAAGCCCTGACCAGGGTAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTGCACATCCTGTC
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Robert A Moran et al. (2017) Analysis of pCERC7, a small antibiotic resistance plasmid from a commensal ST131 Escherichia coli, defines a diverse group of plasmids that include various segments adjacent to a multimer resolution site and encode the same NikA relaxase accessory protein enabling mobilisation. Plasmid. 89:42-48. [PMID:27826018]
Host bacterium
| ID | 1461 | GenBank | KX356458 |
| Plasmid name | pCERC7 | Incompatibility group | ColRNAI |
| Plasmid size | 9712 bp | Coordinate of oriT [Strand] | 2074..2148 [+] |
| Host baterium | Escherichia coli strain 11.1-R1 |
Cargo genes
| Drug resistance gene | resistance to amoxicillin, ampicillin, cephalothin, piperacillin and ticarcillin |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |