Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 100999 |
| Name | oriT_NGR234a |
| Organism | Sinorhizobium fredii NGR234 |
| Sequence Completeness | intact |
| NCBI accession of oriT (coordinates [strand]) | U00090 (512921..512977 [-], 57 nt) |
| oriT length | 57 nt |
| IRs (inverted repeats) | 24..30, 35..41 (ATGTCGC..GCGACGT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note |
oriT sequence
Download Length: 57 nt
>oriT_NGR234a
CCCCGCCAGGGCCGCAAAACAGGATGTCGCGACAGCGACGTATAATTGCGCCCTTGG
CCCCGCCAGGGCCGCAAAACAGGATGTCGCGACAGCGACGTATAATTGCGCCCTTGG
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Sarah L Turner et al. (2002) Identification and analysis of rhizobial plasmid origins of transfer. FEMS microbiology ecology. 42(2):227-34. [PMID:19709282]
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 510341..534825
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| NGR_a03910 (NGR234_80) | 507807..508121 | + | 315 | AAB92446 | conserved hypothetical 11.6 kDa protein | - |
| NGR_a03920 (NGR234_79) | 508261..508527 | + | 267 | AAB92445 | conserved hypothetical 9.9 kDa protein | - |
| NGR_a03930 (NGR234_78) | 508575..509153 | - | 579 | AAB92444 | hypothetical 20.6 kDa protein | - |
| NGR_a03940 (NGR234_77) | 509178..509792 | - | 615 | AAB92443 | conserved hypothetical 22.9 kDa protein | - |
| NGR_a03950 (NGR234_75) | 510341..512263 | - | 1923 | AAB92442 | conjugal transfer protein TraG | virb4 |
| NGR_a03960 (NGR234_74) | 512250..512465 | - | 216 | AAB92441 | conjugal transfer protein TraD | - |
| NGR_a03970 (NGR234_73) | 512470..512778 | - | 309 | AAB92440 | conjugal transfer protein TraC | - |
| NGR_a03980 (NGR234_72) | 513031..516339 | + | 3309 | AAB91648 | conjugal transfer protein TraA | - |
| NGR_a03990 (NGR234_71) | 516336..516902 | + | 567 | AAB91647 | precursor for probable conjugal transfer protein TraF | - |
| NGR_a04000 (NGR234_70) | 516892..518055 | + | 1164 | AAB91646 | conjugal transfer protein TraB | - |
| NGR_a04010 (NGR234_69) | 518072..518674 | + | 603 | AAB91645 | conjugal transfer protein TraH | virB1 |
| NGR_a04030 (NGR234_67) | 520122..520310 | - | 189 | AAB91643 | hypothetical 7 kDa protein | - |
| NGR_a04040 (NGR234_66) | 520682..521911 | - | 1230 | AAB91642 | conserved hypothetical HipA-like protein; symbiotic plasmid stability locus | - |
| NGR_a04050 (NGR234_65) | 521904..522494 | - | 591 | AAB91641 | transcription regulator; symbiotic plasmid stability locus | - |
| NGR_a04070 (NGR234_62) | 523513..523746 | - | 234 | AAB91639 | uncharacterized transcription regulator, XRE family | - |
| NGR_a04080 (NGR234_61) | 523964..524287 | + | 324 | AAB91638 | repressor protein TraM of functions required for conjugal transfer of pNGR234a | - |
| NGR_a04090 (NGR234_60) | 524291..525001 | - | 711 | AAB91637 | LuxR-type activtator protein TraR for conjugal transfer of pNGR234a | - |
| NGR_a04100 (NGR234_59) | 525304..526599 | - | 1296 | AAB92439 | conjugal transfer protein TrbI | virB10 |
| NGR_a04110 (NGR234_58) | 526611..527057 | - | 447 | AAB92438 | precursor for probable conjugal transfer membrane protein TrbG | - |
| NGR_a04120 (NGR234_57) | 527061..527873 | - | 813 | AAB92437 | precursor for probable conjugal transfer protein TrbG | virB9 |
| NGR_a04130 (NGR234_56) | 527891..528553 | - | 663 | AAB92436 | conjugal transfer protein TrbF | virB8 |
| NGR_a04140 (NGR234_55) | 528577..529752 | - | 1176 | AAB92435 | conjugal transfer multi-pass membrane protein TrbL | virB6 |
| NGR_a04150 (NGR234_54) | 529746..529943 | - | 198 | AAB92434 | precursor for probable conjugal transfer protein TrbK | - |
| NGR_a04160 (NGR234_53) | 529940..530743 | - | 804 | AAB92433 | conjugal transfer protein TrbJ | virB5 |
| NGR_a04170 (NGR234_52) | 530715..532703 | - | 1989 | AAB92432 | product corresponding to the carboxy-terminus of conjugal transfer protein TrbE | virb4 |
| NGR_a04180 (NGR234_51) | 532723..533172 | - | 450 | AAB92431 | product corresponding to the amino-terminus of conjugal transfer protein TrbE | virb4 |
| NGR_a04190 (NGR234_50) | 533183..533482 | - | 300 | AAB92430 | conjugal transfer protein TrbD | virB3 |
| NGR_a04200 (NGR234_49) | 533475..533858 | - | 384 | AAB92429 | conjugal transfer protein TrbC | virB2 |
| NGR_a04210 (NGR234_48) | 533848..534825 | - | 978 | AAB92428 | conjugal transfer protein TrbB | virB11 |
| NGR_a04220 (NGR234_47) | 534836..535462 | - | 627 | AAB92427 | autoinducer synthetase TraI for activation of conjugal transfer via TraR | - |
Host bacterium
| ID | 1458 | GenBank | U00090 |
| Plasmid name | pNGR234a | Incompatibility group | - |
| Plasmid size | 536165 bp | Coordinate of oriT [Strand] | 512921..512977 [-] |
| Host baterium | Sinorhizobium fredii NGR234 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | gmd |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | nodD, nodZ, noeL, nopA, nolV, nolU, nolT, nopB, nolW, nolX, mLTONO_5203, nifX, nifK, nifD, nifH, nifS, nifN, nifE, fixA, fixB, fixC, fixX, nifB, nifZ, nifT, nodU, nodA, nodB, nodC, nodI, nodJ, eB233_29665 |
| Anti-CRISPR | - |