Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 100997
• Name: oriT_pColB4
• Organism: Plasmid DEFINITION
• Sequence Completeness: intact
• NCBI accession of oriT (coordinates [strand]): AH003616 (112..235 [+], 124 nt)
• oriT length: 124 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _

oriT sequence

• Length: 124 nt

>oriT_pColB4
GGTTGGTGGTTCTCACCACCAAAAGCACCACACCCCACGCAAAAACAAGTTTTTGCTGATTTGCTTTTTGAATCATTAGCTTATGTTTTAAATAATGTATTTTAATTTATTTTACATTATTAAA

oriT secondary structure

Predicted by RNAfold.

Reference

[1] B B Finlay et al. (1986) Origin of transfer of IncF plasmids and nucleotide sequences of the type II oriT, traM, and traY alleles from ColB4-K98 and the type IV traY allele from R100-1. Journal of bacteriology. 168(1):132-9. [PMID:3531163]

Host bacterium

• ID: 1456
• GenBank: AH003616
• Plasmid name: pColB4
• Incompatibility group: -
• Plasmid size: 1389 bp
• Coordinate of oriT [Strand]: 112..235 [+]
• Host baterium: Plasmid DEFINITION

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -