Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 100219 |
| Name | oriT_pIE522  |
| Organism | Klebsiella pneumoniae |
| Sequence Completeness | core |
| NCBI accession of oriT (coordinates [strand]) | EU247928 ( , 39 nt) |
| oriT length | 39 nt |
| IRs (inverted repeats) | 9..14, 19..24 (CGCACC..GGTGCG) |
| Location of nic site | 32..33 |
| Conserved sequence flanking the nic site |
TGTCT|ATAGC |
| Note | _ |
oriT sequence
Download Length: 39 nt
>oriT_pIE522
GACTTACGCGCACCGAAAGGTGCGTATTGTCTATAGCCC
GACTTACGCGCACCGAAAGGTGCGTATTGTCTATAGCCC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Revilla C et al. (2008) Different pathways to acquiring resistance genes illustrated by the recent evolution of IncW plasmids. Antimicrob Agents Chemother. 52(4):1472-80. [PMID:18268088]
Host bacterium
| ID | 212 | GenBank | EU247928 |
| Plasmid name | pIE522 | Incompatibility group | IncW |
| Plasmid size | 1216 bp | Coordinate of oriT [Strand] | _ |
| Host baterium | Klebsiella pneumoniae |
Cargo genes
| Drug resistance gene | resistance to gentamicin, kanamycin, sulfonamide and tobramycin |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |