Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 100217 |
| Name | oriT_pIE1107  |
| Organism | Uncultured bacterium IncQ-like |
| Sequence Completeness | core |
| NCBI accession of oriT (coordinates [strand]) | Z74787 (943..979 [-], 37 nt) |
| oriT length | 37 nt |
| IRs (inverted repeats) | 3..8, 14..19 (GTTTCTT..AGAAAC) |
| Location of nic site | 30..31 |
| Conserved sequence flanking the nic site |
TAAGTGCG|CCCT |
| Note | similar to the oriT of IncQ plasmid RSF101 |
oriT sequence
Download Length: 37 nt
>oriT_pIE1107
CAGTTTCTTGAAGAGAAACCGGTAAGTGCGCCCTCCC
CAGTTTCTTGAAGAGAAACCGGTAAGTGCGCCCTCCC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Smalla K et al. (2000) Exogenous isolation of antibiotic resistance plasmids from piggery manure slurries reveals a high prevalence and diversity of IncQ-like plasmids. Appl Environ Microbiol. 66(11):4854-62. [PMID:11055935]
[2] Tietze E (1998) Nucleotide sequence and genetic characterization of the novel IncQ-like plasmid pIE1107. Plasmid. 39(3):165-81. [PMID:9571133]
Host bacterium
| ID | 210 | GenBank | Z74787 |
| Plasmid name | pIE1107 | Incompatibility group | IncQ1 |
| Plasmid size | 8520 bp | Coordinate of oriT [Strand] | 943..979 [-] |
| Host baterium | Uncultured bacterium IncQ-like |
Cargo genes
| Drug resistance gene | resistance to streptothricin and kanamycin |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |