Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 100204 |
| Name | oriT_pIMVS1  |
| Organism | S.typhimurium cryptic |
| Sequence Completeness | core |
| NCBI accession of oriT (coordinates [strand]) | X63534 ( , 63 nt) |
| oriT length | 63 nt |
| IRs (inverted repeats) | 17..21, 27..31 (CGTGA..TCACG) 36..39, 40..43 (CGCT..AGCG) |
| Location of nic site | 56..57 |
| Conserved sequence flanking the nic site |
CTGG|CTTA |
| Note | _ |
oriT sequence
Download Length: 63 nt
>oriT_pIMVS1
GGTTTCGGGGCGCAGCCGTGAACCAGTCACGCAGGCGCTAGCGGAGTGTATACTGGCTTAGTA
GGTTTCGGGGCGCAGCCGTGAACCAGTCACGCAGGCGCTAGCGGAGTGTATACTGGCTTAGTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Dery KJ et al. (1997) Characterization of the replication and mobilization regions of the multiresistance Klebsiella pneumoniae plasmid pJHCMW1. Plasmid. 38(2):97-105. [PMID:9339467]
[2] Astill DS et al. (1993) Characterization of the small cryptic plasmid, pIMVS1, of Salmonella enterica ser. Typhimurium. Plasmid. 30(3):258-67. [PMID:8302933]
Host bacterium
| ID | 197 | GenBank | X63534 |
| Plasmid name | pIMVS1 | Incompatibility group | ColRNAI |
| Plasmid size | 3357 bp | Coordinate of oriT [Strand] | _ |
| Host baterium | S.typhimurium cryptic |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |