Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 100203 |
| Name | oriT_pJHCMW1 |
| Organism | Klebsiella pneumoniae |
| Sequence Completeness | intact |
| NCBI accession of oriT (coordinates [strand]) | NC_003486 (1883..2100 [-], 218 nt) |
| oriT length | 218 nt |
| IRs (inverted repeats) | 46..53, 57..64 (TTCGGGGC..GCCCTGAA) 76..80, 86..90 (ACACT..AGTGT) 106..110, 117..122 (GTTAC..GTAACA) |
| Location of nic site | 97..98 |
| Conserved sequence flanking the nic site |
CGGG|CTAA |
| Note | _ |
oriT sequence
Download Length: 218 nt
>oriT_pJHCMW1
GATGGCATGGGGTGATATCCAGTAGCTAAGGGGTTGTTAGCGGGTTTCGGGGCGCAGCCCTGAATCAGTCATGTAACACTAGCAGAGTGTACACGGGCTAAATATGTTACGGAGGAGTAACACTTCGCGAAAGTGCTTCATATGGCAGAGGGAAAATGCAGCGCTAGAGCGTACAGGAGAAAATAGAGGTTACGGTGATATGACGCTTCTTCGCTCAT
GATGGCATGGGGTGATATCCAGTAGCTAAGGGGTTGTTAGCGGGTTTCGGGGCGCAGCCCTGAATCAGTCATGTAACACTAGCAGAGTGTACACGGGCTAAATATGTTACGGAGGAGTAACACTTCGCGAAAGTGCTTCATATGGCAGAGGGAAAATGCAGCGCTAGAGCGTACAGGAGAAAATAGAGGTTACGGTGATATGACGCTTCTTCGCTCAT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Sarno R et al. (2002) Complete nucleotide sequence of Klebsiella pneumoniae multiresistance plasmid pJHCMW1. Antimicrob Agents Chemother. 46(11):3422-7. [PMID:12384346]
[2] Dery KJ et al. (1997) Characterization of the replication and mobilization regions of the multiresistance Klebsiella pneumoniae plasmid pJHCMW1. Plasmid. 38(2):97-105. [PMID:9339467]
Host bacterium
| ID | 196 | GenBank | NC_003486 |
| Plasmid name | pJHCMW1 | Incompatibility group | Col440I |
| Plasmid size | 11354 bp | Coordinate of oriT [Strand] | 1883..2100 [-] |
| Host baterium | Klebsiella pneumoniae |
Cargo genes
| Drug resistance gene | resistance to amikacin (aac(6 )-Ib), tobramycin (aac(6 )-Ib), kanamycin (aac(6 )-Ib); presence of aadA1 (aminoglycoside adenylyltransferase), blaOXA-9 (Beta-Lactam, bla OXA-9), and blaTEM-1 (beta-lactamase CTX-M-14) |
| Virulence gene | _ |
| Metal resistance gene | _ |
| Degradation gene | _ |
| Symbiosis gene | - |
| Anti-CRISPR | - |