Detailed information of oriT

oriT

The information of the oriT region


oriTDB ID   100203
Name   oriT_pJHCMW1 in_silico
Organism   Klebsiella pneumoniae
Sequence Completeness      intact
NCBI accession of oriT (coordinates [strand])   NC_003486 (1883..2100 [-], 218 nt)
oriT length   218 nt
IRs (inverted repeats)      46..53, 57..64  (TTCGGGGC..GCCCTGAA)
  76..80, 86..90  (ACACT..AGTGT)
  106..110, 117..122  (GTTAC..GTAACA)
Location of nic site      97..98
Conserved sequence flanking the
  nic site    		  CGGG|CTAA
Note   _

  oriT sequence  


Download         Length: 218 nt

>oriT_pJHCMW1
GATGGCATGGGGTGATATCCAGTAGCTAAGGGGTTGTTAGCGGGTTTCGGGGCGCAGCCCTGAATCAGTCATGTAACACTAGCAGAGTGTACACGGGCTAAATATGTTACGGAGGAGTAACACTTCGCGAAAGTGCTTCATATGGCAGAGGGAAAATGCAGCGCTAGAGCGTACAGGAGAAAATAGAGGTTACGGTGATATGACGCTTCTTCGCTCAT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Sarno R et al. (2002) Complete nucleotide sequence of Klebsiella pneumoniae multiresistance plasmid pJHCMW1. Antimicrob Agents Chemother. 46(11):3422-7. [PMID:12384346]
[2] Dery KJ et al. (1997) Characterization of the replication and mobilization regions of the multiresistance Klebsiella pneumoniae plasmid pJHCMW1. Plasmid. 38(2):97-105. [PMID:9339467]


Host bacterium

ID   196 GenBank   NC_003486
Plasmid name   pJHCMW1 Incompatibility group   Col440I
Plasmid size   11354 bp Coordinate of oriT [Strand]   1883..2100 [-]
Host baterium   Klebsiella pneumoniae

Cargo genes

Drug resistance gene   resistance to amikacin (aac(6 )-Ib), tobramycin (aac(6 )-Ib), kanamycin (aac(6 )-Ib);

presence of aadA1 (aminoglycoside adenylyltransferase), blaOXA-9 (Beta-Lactam, bla OXA-9), and blaTEM-1 (beta-lactamase CTX-M-14)
Virulence gene   _
Metal resistance gene   _
Degradation gene   _
Symbiosis gene   -
Anti-CRISPR   -