Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 100189
• Name: oriT_pHY320
• Organism: Bacillus subtilis
• Sequence Completeness: core
• NCBI accession of oriT (coordinates [strand]): -
• oriT length: 38 nt
• IRs (inverted repeats): 2..8, 13..19 (ACTTTAT..ATAAAGT)
• Location of nic site: 27..28
• Conserved sequence flanking the nic site: TAGTGTG|TTAT
• Note: _

oriT sequence

• Length: 38 nt

>oriT_pHY320
CACTTTATGAATATAAAGTATAGTGTGTTATACTTTAC

oriT secondary structure

Predicted by RNAfold.

Reference

[1] Grohmann E et al. (2003) Conjugative plasmid transfer in gram-positive bacteria. Microbiol Mol Biol Rev. 67(2):277-301. [PMID:12794193]

Host bacterium

• ID: 182
• GenBank: _
• Plasmid name: pHY320
• Incompatibility group: -
• Plasmid size: _
• Coordinate of oriT [Strand]: _
• Host baterium: Bacillus subtilis

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -