Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 100166 |
| Name | oriT_oriT_pKL1  |
| Organism | Escherichia coli |
| Sequence Completeness | intact |
| NCBI accession of oriT (coordinates [strand]) | NC_002145 (_) |
| oriT length | 100 nt |
| IRs (inverted repeats) | 7..15, 17..25 (GTCGGGGGT..AGCCCTGAC) 32..50, 51..69 (GTAATCGTATCGGCGTGCA..TGCGCGGTTATACGATTAC) |
| Location of nic site | 77..78 |
| Conserved sequence flanking the nic site |
CATCCTG|T |
| Note | _ |
oriT sequence
Download Length: 100 nt
>oriT_oriT_pKL1
CGGGGTGTCGGGGTGAAGCCCTGACCAAGTGGTAATCGTATCGGCGTGCATGCGCGGTTATACGATTACACATCCTGTCCCGATTTCTGAGGCGTTTTAA
CGGGGTGTCGGGGTGAAGCCCTGACCAAGTGGTAATCGTATCGGCGTGCATGCGCGGTTATACGATTACACATCCTGTCCCGATTTCTGAGGCGTTTTAA
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Srivastava P et al. (2006) Characterization of broad host range cryptic plasmid pCR1 from Corynebacterium renale. Plasmid. 56(1):24-34. [PMID:16545871]
[2] Burian et al. (1999) Replication Control of a Small Cryptic Plasmid of Escherichia coli. J Mol Biol. 294(1):49-65. [PMID:10556028]
Host bacterium
| ID | 160 | GenBank | NC_002145 |
| Plasmid name | pKL1 | Incompatibility group | Col |
| Plasmid size | 1549 bp | Coordinate of oriT [Strand] | 334..400 [+] |
| Host baterium | Escherichia coli |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |