Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   100164
Name   oriT_pCD4 in_silico
Organism   Lactococcus lactis subsp. lactis
Sequence Completeness      intact
NCBI accession of oriT (coordinates [strand])   NC_002748 (716..1179 [+], 464 nt)
oriT length   464 nt
IRs (inverted repeats)      IR1: 139..148, 153..162  (CCCATTTTAT..ATAAAATGGG)
  IR2: 208..220, 224..236  (AAAAGGGGAAAGT..ACTTCCCCCTTTT)
  IR3: 243..256, 269..282  (ACATTGTAATACAA..TTGTATTACAATGT)
Location of nic site      290..291
Conserved sequence flanking the
  nic site  
 
 CTTG|CA
Note   similar ot oriT of pGL3, pGL4, pSRQ800, pSRQ900 and pIL7

  oriT sequence  


Download         Length: 464 nt

>oriT_pCD4
TTAGTGGATGAACAAACAAAATACGAGAGATTTTTTGTTCGTTCATCCATGGTTTTAGGAAAAAGAGGGACGATTTCGGAAGAAGAAACTCGTCTCTTTTTTTCTTCTTTTTGTATGACAAAAAGAAAGATCTTTTGCCCATTTTATTTTTATAAAATGGGTAGGTGGCGTTTGCGTAAAGCAAATCGACACAATCCAAAGGGGATAAAAGGGGAAAGTGAAACTTCCCCCTTTTCAAGCAACATTGTAATACAAGAACGAAGTGATTTGTATTACAATGTGATAGCTTGCAGTATTTATGGTTTTATATGGTCTATTTTGTTATAATGATTGTAACCGAATAGGGCGCAATACTTATAACAAAATCAATGACAAAGGGCGATTGAGAAATGAGCGCTGGGGCATTTTATATTTGAGTAAGTTATTGATGGATCAGAAAAATGTATCACAAATTTAAACAAAG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Strahinic I et al. (2009) Molecular characterization of plasmids pS7a and pS7b from Lactococcus lactis subsp. lactis bv. diacetylactis S50 as a base for the construction of mobilizable cloning vectors. J Appl Microbiol. 106(1):78-88. [PMID:19040703]
[2] Emond E et al. (2001) Molecular characterization of a theta replication plasmid and its use for development of a two-component food-grade cloning system for Lactococcus lactis. Appl Environ Microbiol. 67(4):1700-9. [PMID:11282624]


Host bacterium


ID   158 GenBank   NC_002748
Plasmid name   pCD4 Incompatibility group   _
Plasmid size   6094 bp Coordinate of oriT [Strand]   716..1179 [+]
Host baterium   Lactococcus lactis subsp. lactis

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -