Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 100163 |
| Name | oriT_pRAS3.2  |
| Organism | Aeromonas salmonicida |
| Sequence Completeness | intact |
| NCBI accession of oriT (coordinates [strand]) | NC_003124 (1..47 [-], 47 nt) |
| oriT length | 47 nt |
| IRs (inverted repeats) | IR1: 9..14, 42..47 (GGATTG..CAATCC) IR2: 21..26, 30..35 (ACATGC..GCATGT) |
| Location of nic site | 1..2 |
| Conserved sequence flanking the nic site |
C|AGGAT |
| Note |
oriT sequence
Download Length: 47 nt
>oriT_pRAS3.2
CAGGATGCGGATTGTCATACACATGCTACGCATGTTCCTGCCAATCC
CAGGATGCGGATTGTCATACACATGCTACGCATGTTCCTGCCAATCC
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Loftie-Eaton W et al. (2009) Comparative biology of two natural variants of the IncQ-2 family plasmids, pRAS3.1 and pRAS3.2. J Bacteriol. 191(20):6436-46. [PMID:19684126]
Host bacterium
| ID | 1467 | GenBank | NC_003124 |
| Plasmid name | pRAS3.2 | Incompatibility group | IncQ2 |
| Plasmid size | 11823 bp | Coordinate of oriT [Strand] | 1..47 [-] |
| Host baterium | Aeromonas salmonicida |
Cargo genes
| Drug resistance gene | tet(C) |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |