Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   100163
Name   oriT_pRAS3.2 experimental
Organism   Aeromonas salmonicida
Sequence Completeness      intact
NCBI accession of oriT (coordinates [strand])   NC_003124 (1..47 [-], 47 nt)
oriT length   47 nt
IRs (inverted repeats)      IR1: 9..14, 42..47  (GGATTG..CAATCC)
  IR2: 21..26, 30..35  (ACATGC..GCATGT)
Location of nic site      1..2
Conserved sequence flanking the
  nic site  
 
 C|AGGAT
Note   

  oriT sequence  


Download         Length: 47 nt

>oriT_pRAS3.2
CAGGATGCGGATTGTCATACACATGCTACGCATGTTCCTGCCAATCC

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Loftie-Eaton W et al. (2009) Comparative biology of two natural variants of the IncQ-2 family plasmids, pRAS3.1 and pRAS3.2. J Bacteriol. 191(20):6436-46. [PMID:19684126]


Host bacterium


ID   1467 GenBank   NC_003124
Plasmid name   pRAS3.2 Incompatibility group   IncQ2
Plasmid size   11823 bp Coordinate of oriT [Strand]   1..47 [-]
Host baterium   Aeromonas salmonicida

Cargo genes


Drug resistance gene   tet(C)
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -