Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 100155 |
| Name | oriT_pBL1  |
| Organism | Lactococcus lactis subsp. lactis |
| Sequence Completeness | core |
| NCBI accession of oriT (coordinates [strand]) | NC_004955 (10730..10800 [-], 71 nt) |
| oriT length | 71 nt |
| IRs (inverted repeats) | 9..23, 36..50 (CACATTGTAATACAA..TTGTATTACAATGTG) |
| Location of nic site | 58..59 |
| Conserved sequence flanking the nic site |
CTTG|CA |
| Note | lactococcal plasmids transfer origin |
oriT sequence
Download Length: 71 nt
>oriT_pBL1
TTTCAAGCCACATTGTAATACAAGAACGAAGTGATTTGTATTACAATGTGATAGCTTGCAGTATTTATGGT
TTTCAAGCCACATTGTAATACAAGAACGAAGTGATTTGTATTACAATGTGATAGCTTGCAGTATTTATGGT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Sánchez C et al. (2000) Nucleotide sequence and analysis of pBL1, a bacteriocin-producing plasmid from Lactococcus lactis IPLA 972. Plasmid. 44(3):239-49. [PMID:11078650]
Host bacterium
| ID | 149 | GenBank | NC_004955 |
| Plasmid name | pBL1 | Incompatibility group | _ |
| Plasmid size | 10899 bp | Coordinate of oriT [Strand] | 10730..10800 [-] |
| Host baterium | Lactococcus lactis subsp. lactis |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |