Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 100129 |
| Name | oriT_pEC886  |
| Organism | Escherichia coli |
| Sequence Completeness | intact |
| NCBI accession of oriT (coordinates [strand]) | NC_019079 (3500..3587 [-], 88 nt) |
| oriT length | 88 nt |
| IRs (inverted repeats) | 32..36, 40..44 (GTCGC..GCGAC) |
| Location of nic site | 61..62 |
| Conserved sequence flanking the nic site |
CTGG|CTTA |
| Note | ColE1 superfamily |
oriT sequence
Download Length: 88 nt
>oriT_pEC886
TCAGCGGGTGTCGGGGCGAAACCCTGACCCAGTCGCGTAGCGACAGCGGAGTGTATACTGGCTTAACCATGCGGCATCAGTGCAGATT
TCAGCGGGTGTCGGGGCGAAACCCTGACCCAGTCGCGTAGCGACAGCGGAGTGTATACTGGCTTAACCATGCGGCATCAGTGCAGATT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 124 | GenBank | NC_019079 |
| Plasmid name | pEC886 | Incompatibility group | ColRNAI |
| Plasmid size | 9261 bp | Coordinate of oriT [Strand] | 3500..3587 [-] |
| Host baterium | Escherichia coli |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |