Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 100125 |
| Name | oriT_pSF301-1  |
| Organism | Shigella flexneri |
| Sequence Completeness | intact |
| NCBI accession of oriT (coordinates [strand]) | NC_019251 (_) |
| oriT length | 100 nt |
| IRs (inverted repeats) | 32..50, 51..69 (GTAATCGTATCGGCGTGCA..TGCGCGGTTATACGATTAC) |
| Location of nic site | 77..78 |
| Conserved sequence flanking the nic site |
CATCCTG|T |
| Note | _ |
oriT sequence
Download Length: 100 nt
>oriT_pSF301-1
CGGGGTGTCGGGGTGAAGCCCTGACCAAGTGGTAATCGTATCGGCGTGCATGCGCGGTTATACGATTACACATCCTGTCCCGATTTCTGAGGCGTTTTAA
CGGGGTGTCGGGGTGAAGCCCTGACCAAGTGGTAATCGTATCGGCGTGCATGCGCGGTTATACGATTACACATCCTGTCCCGATTTCTGAGGCGTTTTAA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 120 | GenBank | NC_019251 |
| Plasmid name | pSF301-1 | Incompatibility group | Col |
| Plasmid size | 1549 bp | Coordinate of oriT [Strand] | |
| Host baterium | Shigella flexneri |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |