Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 100122
• Name: oriT_pHE1
• Organism: Halomonas elongata ATCC 33174
• Sequence Completeness: incomplete
• NCBI accession of oriT (coordinates [strand]): -
• oriT length: 22 nt
• IRs (inverted repeats): _
• Location of nic site: 18..19
• Conserved sequence flanking the nic site: ATGG|CTTA
• Note: ColE1 superfamily

oriT sequence

• Length: 22 nt

>oriT_pHE1
GCCCTCTGTGTATAATGGCTTA

oriT secondary structure

Predicted by RNAfold.

Reference

[1] Vargas C et al. (1999) Genetic organization of the mobilization region of the plasmid pHE1 from Halomonas elongata. Syst Appl Microbiol. 22(4):520-9. [PMID:10794139]

Auxiliary protein

MobB_pHE1

• ID: 175
• GenBank: _
• Name: MobB_pHE1
• UniProt ID: _
• Length: a.a.
• PDB ID: _

Auxiliary protein sequence

• Length: a.a.
• Molecular weight: Da
• Isoelectric Point:

Protein domains

No domain identified.

Protein structure

No available structure.

Reference

[1] Vargas C et al. (1999) Genetic organization of the mobilization region of the plasmid pHE1 from Halomonas elongata. Syst Appl Microbiol. 22(4):520-9. [PMID:10794139]

MobC_pHE1

• ID: 176
• GenBank: _
• Name: MobC_pHE1
• UniProt ID: _
• Length: a.a.
• PDB ID: _

Auxiliary protein sequence

• Length: a.a.
• Molecular weight: Da
• Isoelectric Point:

Protein domains

No domain identified.

Protein structure

No available structure.

Reference

[1] Vargas C et al. (1999) Genetic organization of the mobilization region of the plasmid pHE1 from Halomonas elongata. Syst Appl Microbiol. 22(4):520-9. [PMID:10794139]

Host bacterium

• ID: 117
• GenBank: _
• Plasmid name: pHE1
• Incompatibility group: -
• Plasmid size: 4.2 kb
• Coordinate of oriT [Strand]: _
• Host baterium: Halomonas elongata ATCC 33174

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -