Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 100108 |
| Name | oriT_pRmeGR4a  |
| Organism | Sinorhizobium meliloti GR4 |
| Sequence Completeness | core |
| NCBI accession of oriT (coordinates [strand]) | NC_019846 (79155..79213 [-], 59 nt) |
| oriT length | 59 nt |
| IRs (inverted repeats) | 4..14, 18..28 (GGAAAACGGCG..CACATTTTTCC) |
| Location of nic site | 36..37 |
| Conserved sequence flanking the nic site |
TATCCTG|C |
| Note | P-type plasmid oriTs |
oriT sequence
Download Length: 59 nt
>oriT_pRmeGR4a
GCAGGAAAACGGCGTAGCACATTTTTCCGTATCCTGCCCCTCCACATTGTAAGGGGATT
GCAGGAAAACGGCGTAGCACATTTTTCCGTATCCTGCCCCTCCACATTGTAAGGGGATT
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Herrera-Cervera JA et al. (1998) Cloning and identification of conjugative transfer origins in the Rhizobium meliloti genome. J Bacteriol. 180(17):4583-90. [PMID:9721299]
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 95867..105767
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| C770_RS33875 (C770_GR4pA087) | 91905..92894 | + | 990 | WP_015241449 | aldo/keto reductase | - |
| C770_RS33880 (C770_GR4pA088) | 92916..93500 | + | 585 | WP_015241450 | flavodoxin | - |
| C770_RS33885 (C770_GR4pA090) | 93777..95870 | - | 2094 | WP_015241452 | type IV secretory system conjugative DNA transfer family protein | - |
| C770_RS33890 (C770_GR4pA091) | 95867..96895 | - | 1029 | WP_015241453 | P-type DNA transfer ATPase VirB11 | virB11 |
| C770_RS33895 (C770_GR4pA092) | 96876..98078 | - | 1203 | WP_015241454 | type IV secretion system protein VirB10 | virB10 |
| C770_RS33900 (C770_GR4pA093) | 98078..98887 | - | 810 | WP_015241455 | TrbG/VirB9 family P-type conjugative transfer protein | virB9 |
| C770_RS33905 (C770_GR4pA094) | 98884..99579 | - | 696 | WP_015241456 | type IV secretion system protein | virB8 |
| C770_RS33910 (C770_GR4pA095) | 99605..100633 | - | 1029 | WP_015241457 | type IV secretion system protein | virB6 |
| C770_RS33915 (C770_GR4pA096) | 100649..100876 | - | 228 | WP_015241458 | hypothetical protein | - |
| C770_RS33920 (C770_GR4pA097) | 100866..101567 | - | 702 | WP_015241459 | type IV secretion system protein | - |
| C770_RS33925 (C770_GR4pA098) | 101579..102667 | - | 1089 | WP_015241460 | lytic transglycosylase domain-containing protein | - |
| C770_RS33930 (C770_GR4pA099) | 102664..105123 | - | 2460 | WP_015241461 | VirB4 family type IV secretion/conjugal transfer ATPase | virb4 |
| C770_RS33935 (C770_GR4pA100) | 105126..105425 | - | 300 | WP_014531077 | VirB3 family type IV secretion system protein | virB3 |
| C770_RS33940 (C770_GR4pA101) | 105429..105767 | - | 339 | WP_015241462 | TrbC/VirB2 family protein | virB2 |
| C770_RS33945 (C770_GR4pA102) | 105779..106690 | - | 912 | WP_041169682 | lytic transglycosylase domain-containing protein | - |
| C770_RS33950 (C770_GR4pA103) | 106913..107521 | + | 609 | WP_041169683 | hypothetical protein | - |
| C770_RS33955 (C770_GR4pA104) | 107518..108054 | + | 537 | WP_015241465 | Micrococcal nuclease-like protein (thermonuclease) | - |
| C770_RS33960 (C770_GR4pA105) | 108051..108752 | + | 702 | WP_015241466 | thermonuclease family protein | - |
| C770_RS33965 | 108753..109145 | + | 393 | WP_234704557 | hypothetical protein | - |
| C770_RS33970 (C770_GR4pA106) | 109142..109720 | + | 579 | WP_015241467 | hypothetical protein | - |
| C770_RS33975 (C770_GR4pA107) | 109743..110159 | + | 417 | WP_015241468 | hypothetical protein | - |
| C770_RS33980 (C770_GR4pA108) | 110242..110577 | - | 336 | WP_015241469 | hypothetical protein | - |
Host bacterium
| ID | 103 | GenBank | NC_019846 |
| Plasmid name | pRmeGR4a | Incompatibility group | - |
| Plasmid size | 175983 bp | Coordinate of oriT [Strand] | 79155..79213 [-] |
| Host baterium | Sinorhizobium meliloti GR4 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | actP, silP |
| Degradation gene | RPYSC3_16500 |
| Symbiosis gene | - |
| Anti-CRISPR | - |