Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 100101 |
| Name | oriT_pCE10D  |
| Organism | Escherichia coli O7:K1 str. CE10 |
| Sequence Completeness | core |
| NCBI accession of oriT (coordinates [strand]) | CP003038 (_) |
| oriT length | 100 nt |
| IRs (inverted repeats) | 32..41, 60..69 (GTAATCGTAT.. ATACGATTAC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | _ |
oriT sequence
Download Length: 100 nt
>oriT_pCE10D
CGGGGTGTCGGGGTGAAGCCCTGACCAAGTGGTAATCGTATCGGCGTGCATGCGCGGTTATACGATTACACATCCTGTCCCGATTTCTGAGGCGTTTTAA
CGGGGTGTCGGGGTGAAGCCCTGACCAAGTGGTAATCGTATCGGCGTGCATGCGCGGTTATACGATTACACATCCTGTCCCGATTTCTGAGGCGTTTTAA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 96 | GenBank | CP003038 |
| Plasmid name | pCE10D | Incompatibility group | Col |
| Plasmid size | 1549 bp | Coordinate of oriT [Strand] | |
| Host baterium | Escherichia coli O7:K1 str. CE10 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |