Detailed information of oriT

oriT

The information of the oriT region


oriTDB ID   100095
Name   oriT_pNPO1 in_silico
Organism   Escherichia coli strain W1058
Sequence Completeness      intact
NCBI accession of oriT (coordinates [strand])   KF992024 (81..254 [+], 174 nt)
oriT length   174 nt
IRs (inverted repeats)      IR1: 4..11, 15..22  (TTCGGGGC..GCCCTGAA)
  IR2: 87..91, 94..98  (TGAAG..CTTCA)
Location of nic site      55..56
Conserved sequence flanking the
  nic site    		  CTGG|CTTA
Note   

  oriT sequence  


Download         Length: 174 nt

>oriT_pNPO1
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTAATATGTTGGCACGGATGCGGATGTCAGTGAAGTGCTTCATGTAGCAGGAGAAAAAGGCGGCACCGGCGCGTCAGCAGAACATGTAGTAACGGGAGATGTGCCGCTTCCTCGCTCA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Porres-Osante N et al. (2014) Emergence of a multiresistant KPC-3 and VIM-1 carbapenemase-producing Escherichia coli strain in Spain. J Antimicrob Chemother. 69(7):1792-5. [PMID:24583362]


Host bacterium

ID   90 GenBank   KF992024
Plasmid name   pNPO1 Incompatibility group   Col440I
Plasmid size   1917 bp Coordinate of oriT [Strand]   81..254 [+]
Host baterium   Escherichia coli strain W1058

Cargo genes

Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -