Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 100089 |
| Name | oriT_pAST4  |
| Organism | Uncultured bacterium AST4 |
| Sequence Completeness | core |
| NCBI accession of oriT (coordinates [strand]) | NC_025099 (2926..2960 [+], 35 nt) |
| oriT length | 35 nt |
| IRs (inverted repeats) | 1..6, 10..15 (CCAGAA..TTCTGG) |
| Location of nic site | 24..25 |
| Conserved sequence flanking the nic site |
TACCGTG|TTAT |
| Note | _ |
oriT sequence
Download Length: 35 nt
>oriT_pAST4
CCAGAAGAATTCTGGTATACCGTGTTATACCAAAT
CCAGAAGAATTCTGGTATACCGTGTTATACCAAAT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Alippi AM et al. (2014) Tetracycline-resistance encoding plasmids from Paenibacillus larvae, the causal agent of American foulbrood disease, isolated from commercial honeys. Int Microbiol. 17(1):49-61. [PMID:25296446]
Host bacterium
| ID | 84 | GenBank | NC_025099 |
| Plasmid name | pAST4 | Incompatibility group | - |
| Plasmid size | 5031 bp | Coordinate of oriT [Strand] | 2926..2960 [+] |
| Host baterium | Uncultured bacterium AST4 |
Cargo genes
| Drug resistance gene | resistance to tetracycline |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |