Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   100070
Name   oriT_pIL1 in_silico
Organism   Lactococcus lactis subsp. lactis
Sequence Completeness      intact
NCBI accession of oriT (coordinates [strand])   NC_015860 (_)
oriT length   277 nt
IRs (inverted repeats)      IR1: 91..100, 105..114  (CCCATTTTAT..ATAAAATGGG)
  IR2: 160..172, 176..188  (AAAAGGGGAAAGT..ACTTCCCCCTTTT)
  IR3: 195..208, 221..234  (ACATTGTAATACAA..TTGTATTACAATGT)
Location of nic site      243..244
Conserved sequence flanking the
  nic site  
 
 CTTG|CA
Note   similar to pCD4 plasmid oriT; Lactococcus lactis oriT

  oriT sequence  


Download         Length: 277 nt

>oriT_pIL1
ATGGTTTTAGAAAAAAGAGGGACGATTTCGGAAGAAGAAAATCGTCTCTTTTTTTTCTTCTTTTTGTATGACAAAAAGAAAGATCTTTTGCCCATTTTATTTTTATAAAATGGGTAGGTGGCGTTTGCGTAAAGCAAATCGACACAATCCAAAGGGGATAAAAGGGGAAAGTGAAACTTCCCCCTTTTCAAGCCACATTGTAATACAAGAACGAAGTGCTTTGTATTACAATGTGATAGCTTGCAGTATTTATGGTTTTATATGGTCTATTTTGTTG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Górecki RK et al. (2011) Adaptative potential of the Lactococcus lactis IL594 strain encoded in its 7 plasmids. PLoS One. 6(7):e22238. [PMID:21789242]


Host bacterium


ID   66 GenBank   NC_015860
Plasmid name   pIL1 Incompatibility group   _
Plasmid size   6382 bp Coordinate of oriT [Strand]   
Host baterium   Lactococcus lactis subsp. lactis

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -