Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 100069 |
| Name | oriT_pPAB19-2  |
| Organism | Escherichia coli |
| Sequence Completeness | intact |
| NCBI accession of oriT (coordinates [strand]) | NC_019084 (677..851 [-], 175 nt) |
| oriT length | 175 nt |
| IRs (inverted repeats) | IR1: 2..11, 15..24 (GTTTCGGGGC..GCCCTGAACC) IR2: 92..98, 99..105 (TGCTTCA..TGTAGCA) |
| Location of nic site | 55..56 |
| Conserved sequence flanking the nic site |
CTGG|CTGA |
| Note | ColE1 superfamily |
oriT sequence
Download Length: 175 nt
>oriT_pPAB19-2
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTGACTATGTTGGCACGGATGTGGAAATCAGTGAAGTGCTTCATGTAGCAGGAGAAAAAAGGCGGCACCAGCGCGTCAGCAGGATATGTAGTACAGGATATATTCCGCTTCCTCGCTCAC
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTGACTATGTTGGCACGGATGTGGAAATCAGTGAAGTGCTTCATGTAGCAGGAGAAAAAAGGCGGCACCAGCGCGTCAGCAGGATATGTAGTACAGGATATATTCCGCTTCCTCGCTCAC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Tran T et al. (2012) Small plasmids harboring qnrB19: a model for plasmid evolution mediated by site-specific recombination at oriT and Xer sites. Antimicrob Agents Chemother. 56(4):1821-7. [PMID:22290975]
Host bacterium
| ID | 65 | GenBank | NC_019084 |
| Plasmid name | pPAB19-2 | Incompatibility group | Col440I |
| Plasmid size | 3082 bp | Coordinate of oriT [Strand] | 677..851 [-] |
| Host baterium | Escherichia coli |
Cargo genes
| Drug resistance gene | qnrB19 |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |