Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   100062
Name   oriT_pPAB19-4 in_silico
Organism   Salmonella sp. M9397
Sequence Completeness      intact
NCBI accession of oriT (coordinates [strand])   NC_019279 (677..851 [-], 175 nt)
oriT length   175 nt
IRs (inverted repeats)      IR1: 2..11, 15..24  (GTTTCGGGGC..GCCCTGAACC)
  IR2: 92..98, 99..105  (TGCTTCA..TGTAGCA)
Location of nic site      55..56
Conserved sequence flanking the
  nic site  
 
 CTGG|CTGA
Note   ColE1 superfamily

  oriT sequence  


Download         Length: 175 nt

>oriT_pPAB19-4
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTGACTATGTTGGCACGGATGTGGAAATCAGTGAAGTGCTTCATGTAGCAGGAGAAAAAAGGCGGCACCAGCGCGTCAGCAGGATATGTAGTACAGGATATATTCCGCTTCCTCGCTCAC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Tran T et al. (2012) Small plasmids harboring qnrB19: a model for plasmid evolution mediated by site-specific recombination at oriT and Xer sites. Antimicrob Agents Chemother. 56(4):1821-7. [PMID:22290975]


Host bacterium


ID   58 GenBank   NC_019279
Plasmid name   pPAB19-4 Incompatibility group   Col440I
Plasmid size   2702 bp Coordinate of oriT [Strand]   677..851 [-]
Host baterium   Salmonella sp. M9397

Cargo genes


Drug resistance gene   qnrB19
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -