Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 100046
• Name: oriT_pTiR10
• Organism: Agrobacterium tumefaciens
• Sequence Completeness: core
• NCBI accession of oriT (coordinates [strand]): -
• oriT length: 37 nt
• IRs (inverted repeats): 18..23, 27..32 (CGTCGT..ACGACG)
• Location of nic site: 7..8
• Conserved sequence flanking the nic site: _
• Note: Ti plasmid

oriT sequence

• Length: 37 nt

>oriT_pTiR10
CCAAGGGCGCAATTATACGTCGTGATACGACGCGTTG

oriT secondary structure

Predicted by RNAfold.

Reference

[1] Wetzel ME et al. (2014) Quorum-dependent mannopine-inducible conjugative transfer of an Agrobacterium opine-catabolic plasmid. J Bacteriol. 196(5):1031-44. [PMID:24363349]
[2] Cho H et al. (2007) TraA, TraC and TraD autorepress two divergent quorum-regulated promoters near the transfer origin of the Ti plasmid of Agrobacterium tumefaciens. Mol Microbiol. 63(6):1769-82. [PMID:17367394]

Host bacterium

• ID: 44
• GenBank: _
• Plasmid name: pTiR10
• Incompatibility group: _
• Plasmid size: _
• Coordinate of oriT [Strand]: _
• Host baterium: Agrobacterium tumefaciens

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -