Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 100019 |
| Name | oriT_pCR1  |
| Organism | Corynebacterium renale |
| Sequence Completeness | intact |
| NCBI accession of oriT (coordinates [strand]) | NC_004833 (491..576 [-], 86 nt) |
| oriT length | 86 nt |
| IRs (inverted repeats) | 34..52, 55..73 (GCAAACGGAATATCGTCGC..GTGACGGTATTACATTTGC) |
| Location of nic site | 81..82 |
| Conserved sequence flanking the nic site |
CATCCTG|T |
| Note | _ |
oriT sequence
Download Length: 86 nt
>oriT_pCR1
TACGGGGTGTCGGGGCGAAGCCCTGACCAGATGGCAAACGGAATATCGTCGCGGGTGACGGTATTACATTTGCACATCCTGTCCCG
TACGGGGTGTCGGGGCGAAGCCCTGACCAGATGGCAAACGGAATATCGTCGCGGGTGACGGTATTACATTTGCACATCCTGTCCCG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Srivastava P et al. (2006) Characterization of broad host range cryptic plasmid pCR1 from Corynebacterium renale. Plasmid. 56(1):24-34. [PMID:16545871]
Host bacterium
| ID | 18 | GenBank | NC_004833 |
| Plasmid name | pCR1 | Incompatibility group | Col |
| Plasmid size | 1488 bp | Coordinate of oriT [Strand] | 491..576 [-] |
| Host baterium | Corynebacterium renale |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |