Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 100011 |
| Name | oriT_pPS12-1  |
| Organism | Burkholderia sp. PS12 |
| Sequence Completeness | incomplete |
| NCBI accession of oriT (coordinates [strand]) | AF073903 ( , 67 nt) |
| oriT length | 67 nt |
| IRs (inverted repeats) | 49..53, 56..60 (CCGGC..GCCGG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | _ |
oriT sequence
Download Length: 67 nt
>oriT_pPS12-1
GCCCGTTGAGTGCCGCAGGCGCGAATAAGGGACAGCGAAGATAGATAACCGGCCCGCCGGTTAGCTA
GCCCGTTGAGTGCCGCAGGCGCGAATAAGGGACAGCGAAGATAGATAACCGGCCCGCCGGTTAGCTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Beil S et al. (1999) Genetic and biochemical analyses of the tec operon suggest a route for evolution of chlorobenzene degradation genes. J Bacteriol. 181(1):341-6. [PMID:9864349]
Host bacterium
| ID | 10 | GenBank | AF073903 |
| Plasmid name | pPS12-1 | Incompatibility group | IncP1 |
| Plasmid size | 67 bp | Coordinate of oriT [Strand] | _ |
| Host baterium | Burkholderia sp. PS12 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | degradation of tetrachlorobenzene |
| Symbiosis gene | - |
| Anti-CRISPR | - |