Detailed information of oriT

oriT

The information of the oriT region


oriTDB ID   100010
Name   oriT_pMUR274 experimental
Organism   pMUR274
Sequence Completeness      intact
NCBI accession of oriT (coordinates [strand])   AF011924 (399..873 [-], 475 nt)
oriT length   475 nt
IRs (inverted repeats)      IR1: 145..155, 161..171  (ATATGTAATAC..GTATTACATAT)
  IR2: 208..218, 223..233  (GCATTTACGAT..ATCGTAATTGC)
  IR3: 335..344, 347..356  (CCTTTCATGC..GCATGAAAGG)
Location of nic site      242..243
Conserved sequence flanking the
  nic site    		  GGTGT|ATAGC
Note   minimal oriT region; N-type oriT

  oriT sequence  


Download         Length: 475 nt

>oriT_pMUR274
ACTCCGATACGTTGCCCTCCGAACGGTATTCAAGGTCGATTTTTTGCGCTTCGGTCACTCTTAAACTGATAGATGGCATAGGTTTCCTTTGTGTAATACCGATGTAATACATACAAATCTAGCATAGATGCGGCTTAATTCCACATATGTAATACGTTGTGTATTACATATTAAAACACAAATTAGAATAATTTGTTTTGTTTTCAAGCATTTACGATGAAAATCGTAATTGCGTATGGTGTATAGCCGTTAAGGGATACCATACCACGCCTTTTTTAAGGGAGAAACCGGTGTTACGTGCAAGTGAATCGCTCAAAAAGCGTTCACATTCACACCTTTCATGCTTGCATGAAAGGAAACGGACGGGAATTAGACAAAAATAAGACACGATGAGTAAGTTATTGAGACAAGAAAAGGACACAAATAAGACATTTTTTAGAAAAAAACATTGACTTGAGACTAGAAATGGACAATA

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Paterson ES et al. (1997) Localization of the nic site of IncN conjugative plasmid pCU1 through formation of a hybrid oriT. J Bacteriol. 179(18):5768-76. [PMID:9294433]
[2] Paterson ES et al. (1992) The oriT region of the conjugative transfer system of plasmid pCU1 and specificity between it and the mob region of other N tra plasmids. J Bacteriol. 174(2):499-507. [PMID:1309528]


Host bacterium

ID   9 GenBank   AF011924
Plasmid name   pMUR274 Incompatibility group   IncN
Plasmid size   1375 bp Coordinate of oriT [Strand]   399..873 [-]
Host baterium   pMUR274

Cargo genes

Drug resistance gene   _
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -