 oriTDB accession number | 200072 |
| Name | oriT_ICEVflInd1  |
Sequence Completeness  | intact |
| oriT length | 299 nt |
| oriT sequence | GCTCTGTTTGGCGGCTGGTGACCTAGCCAAAAAAATTGAGACGCCAAACGTCGTTTGCAT TCTGGCCTGAACTTGCCAAACGGTTTGTATCTTCATGGCGATACGTCTTTTTAGGTGTTT TTAAGTGAAATCAGCCTGTATCCCTTGTCGGGTATGGGATTGAGCGAGTCGATTTATATC GAGACGCCAAACAGTGATTGTGACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCA AACGGATAGTGGTTTTGGCTTTAGGGGTTAATTGGATGGGGAAATTGGTTTGGTAGAAA |
| IR (inverted repeat) | [178-192] [216-230] nt (ATCGAGACGCCAAAC..GTTTGGCGTTTCGAT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site | _ |
| Note | _ |
Visualization of oriT structure Reference| [1] Wozniak RA et al (2009) Comparative ICE genomics: insights into the evolution of the SXT/R391 family of ICEs. PLoS Genet. 5(12):e1000786. [PMID:20041216] |
| [2] Daccord A et al (2010) Integrating conjugative elements of the SXT/R391 family trigger the excision and drive the mobilization of a new class of Vibrio genomic islands. Mol Microbiol. 78(3):576-88. [PMID:20807202] |
| ID | 80 |
| Element type | _ |
| ICE description | ICEVflInd1 |
| ICEberg accesion number | 36 |
| GenBank accession number | GQ463144.1 |
| Family | SXT/R391 |
| Genome size | 114195 bp |
| Coordinate of oriT [+/-] | 20965..21263 [+] |
| Drug resistance | Antibiotic resistance genes: dfr18, floR, strBA, sul2 |
| Heavy-metal resistance | _ |
| Virulence factor | _ |
| Xenobiotic degradation | _ |
| Host bacterium [NCBI Taxonomy ID] | Vibrio fluvialis Ind1 [563774] |
Reference| [1] Wozniak RA et al (2009) Comparative ICE genomics: insights into the evolution of the SXT/R391 family of ICEs. PLoS Genet. 5(12):e1000786. [PMID:20041216] |
| [2] Daccord A et al (2010) Integrating conjugative elements of the SXT/R391 family trigger the excision and drive the mobilization of a new class of Vibrio genomic islands. Mol Microbiol. 78(3):576-88. [PMID:20807202] |