 oriTDB accession number | 200058 |
| Name | oriT_ICESpuPO1  |
Sequence Completeness  | intact |
| oriT length | 299 nt |
| oriT sequence | GCGCTGTTTGGCGGCGGATGACTGAGCCAAAAAAATCGAGACGCCAAACGTCGTTTGCAT TCTGGCCTGAACTCGCCAAACGGTTTGTATCTTCATGACGATACGTCTTTTTAGGCGTTT TTAAGTGAAATCGGGCTGTATCCCTTGTCAGGTATGGGATTGCGCGAGTTGATTTATATC GAGACGCCAAACAGTGATTGTGACGGTAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCA AACGGATAGTGGTTTTGGCTTTTGGGGTTAATTGGGTGAGGAAATTGGTTTGGTAGAAA |
| IR (inverted repeat) | [178-192] [216-230] nt (ATCGAGACGCCAAAC..GTTTGGCGTTTCGAT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site | _ |
| Note | _ |
Visualization of oriT structure Reference| [1] Ceccarelli D et al (2008) Identification of the origin of transfer (oriT) and a new gene required for mobilization of the SXT/R391 family of integrating conjugative elements. J Bacteriol. 190(15):5328-38. [PMID:18539733] |
| [2] Wozniak RA et al (2009) Comparative ICE genomics: insights into the evolution of the SXT/R391 family of ICEs. PLoS Genet. 5(12):e1000786. [PMID:20041216] |
| ID | 66 |
| Element type | _ |
| ICE description | ICESpuPO1 |
| ICEberg accesion number | 39 |
| GenBank accession number | NC_008750.1 |
| Family | SXT/R391 |
| Genome size | 111191 bp |
| Coordinate of oriT [+/-] | 1228915..1229213 [+] |
| Drug resistance | _ |
| Heavy-metal resistance | _ |
| Virulence factor | _ |
| Xenobiotic degradation | _ |
| Host bacterium [NCBI Taxonomy ID] | Shewanella sp. W3-18-1 [351745] |
Reference| [1] Ceccarelli D et al (2008) Identification of the origin of transfer (oriT) and a new gene required for mobilization of the SXT/R391 family of integrating conjugative elements. J Bacteriol. 190(15):5328-38. [PMID:18539733] |
| [2] Wozniak RA et al (2009) Comparative ICE genomics: insights into the evolution of the SXT/R391 family of ICEs. PLoS Genet. 5(12):e1000786. [PMID:20041216] |