 oriTDB accession number | 200055 |
| Name | oriT_Tn6087  |
Sequence Completeness  | intact |
| oriT length | 215 nt |
| oriT sequence | AAGCGGAAGTCGCAGGTGTGGACTGATCTTGCTGGCTGGTGTGGCAATAGCCACGCCAGC ACTTAACCCCCCGTATCTAACAGGGGGGTACAAATCGACAGGAAACAGTCAAAAAAACAT TAGAAAATCCTTTGGTTACAAGGGATTTACAAAATTTCAGCGTTTGTCAAATGGGCTTTA AAAGTTGACATACGCCTTTTTGATTGGAGGGATTT |
| IR (inverted repeat) | [61-76] [80-95] nt (ACTTAACCCCCCGTAT..ACAGGGGGGTACAAAT) [123-134] [139-150] nt (GAAAATCCTTTG..CAAGGGATTTAC) |
| Location of nic site | [135-136] nt |
| Conserved sequence flanking the nic site | TGG|T |
| Note | blastn alignment with the oriT_Tn916 |
Visualization of oriT structure Reference| ID | 269 |
| Name | ORF21_Tn6087 |
| SecReT4 accesion number | _ |
| GenBank accession number | ADV76295 |
| Family | TrwB/TraD |
| Length | 461 |
| UniProt ID | E9NM67 |
| PDB ID | _ |
| Pfam | FtsK_SpoIIIE [PF01580.17], Evalue: 2.50E-07, Aligned region: 206..313 DUF87 [PF01935.16], Evalue: 4.40E-05, Aligned region: 216..352 |
| Note | FtsK/SpoIIIE family protein; Tn916-like ORF21 |
| Protein sequence [Download] |
Reference| ID | 60 |
| Element type | Tn916-like |
| ICE description | Tn6087 |
| ICEberg accesion number | 326 |
| GenBank accession number | HQ663849.2 |
| Family | Tn916 |
| Genome size | 21169 bp |
| Coordinate of oriT [+/-] | 2441..2655 [+] |
| Drug resistance |  resistance to minocycline and tetracycline |
| Heavy-metal resistance | _ |
| Virulence factor | _ |
| Xenobiotic degradation | _ |
| Host bacterium [NCBI Taxonomy ID] | Streptococcus oralis F.MI.5 [1303] |
Reference| [1] Ciric L et al (2011) Antibiotic and antiseptic resistance genes are linked on a novel mobile genetic element: Tn6087. J Antimicrob Chemother. 66(10):2235-9. [PMID:21816764] |