 oriTDB accession number | 200034 |
| Name | oriT_Tn925  |
Sequence Completeness  | intact |
| oriT length | 215 nt |
| oriT sequence | AAGCGGAAGTCGCAGGTGTGGACTGATCTTGCTGGCTGGTGTGGCAATAGCCACGCCAGC ACTTAACCCCCCGTATCTAACAGGGGGGTACAAATCGACAGGAAACAGTCAAAAAAACAT TAGAAAATCCTTTGGTTACAAGGGATTTACAAAATTTCAGCGTATGTCAAATGGGCTTTA AAAGTTGACATACGCCTTTTTGATTGGAGGGATTT |
| IR (inverted repeat) | [61-76] [80-95] nt (ACTTAACCCCCCGTAT..ACAGGGGGGTACAAAT) [123-134] [139-150] nt (GAAAATCCTTTG..CAAGGGATTTAC) |
| Location of nic site | [135-136] nt |
| Conserved sequence flanking the nic site | TGG|T |
| Note | blastn alignment with the oriT_Tn916 |
Visualization of oriT structure Reference| ID | 39 |
| Element type | Tn916-like transposon in Enterococcus faecalis plasmid pCF10 |
| ICE description | Tn925 |
| ICEberg accesion number | 306 |
| GenBank accession number | AY855841.2 |
| Family | Tn916 |
| Genome size | 18032 bp |
| Coordinate of oriT [+/-] | 55445..55659 [-] |
| Drug resistance | _ |
| Heavy-metal resistance | _ |
| Virulence factor | _ |
| Xenobiotic degradation | _ |
| Host bacterium [NCBI Taxonomy ID] | Enterococcus faecalis [1351] |
Reference| [1] Kao SM et al (1991) Molecular and genetic analysis of a region of plasmid pCF10 containing positive control genes and structural genes encoding surface proteins involved in pheromone-inducible conjugation in Enterococcus faecalis. J Bacteriol. 173(23):7650-64. [PMID:1938961] |
| [2] Torres OR et al (1991) The conjugative transposon Tn925: enhancement of conjugal transfer by tetracycline in Enterococcus faecalis and mobilization of chromosomal genes in Bacillus subtilis and E. faecalis. Mol Gen Genet. 225(3):395-400. [PMID:1850085] |
| [3] Guffanti AA et al (1991) Transfer of Tn925 and plasmids between Bacillus subtilis and alkaliphilic Bacillus firmus OF4 during Tn925-mediated conjugation. J Bacteriol. 173(5):1686-9. [PMID:1847906] |