 oriTDB accession number | 200005 |
| Name | oriT_Tn6086  |
Sequence Completeness  | core |
| oriT length | 23 nt |
| oriT sequence | GCCCCCTCTATCTAACAGGGGGG |
| IR (inverted repeat) | [2-7] [17-22] nt (CCCCCT..AGGGGG) |
| Location of nic site | [13-14] nt |
| Conserved sequence flanking the nic site | _ |
| Note | similar to oriT/nicK recognition site of ICEBs1 |
Visualization of oriT structure Reference| ID | 10 |
| Element type | ICE (Conjugative transposon) |
| ICE description | Tn6086 |
| ICEberg accesion number | 427 |
| GenBank accession number | HM636636.1 |
| Family | Tn5801 |
| Genome size | 24468 bp |
| Coordinate of oriT [+/-] | 7493..7515 [+] |
| Drug resistance | _ |
| Heavy-metal resistance | _ |
| Virulence factor | _ |
| Xenobiotic degradation | _ |
| Host bacterium [NCBI Taxonomy ID] | Enterococcus faecium strain TC 6 [1352] |
Reference