 oriTDB accession number | 100219 |
| Name | oriT_pIE522  |
Sequence Completeness  | core |
| oriT length | 39 nt |
| oriT sequence | GACTTACGCGCACCGAAAGGTGCGTATTGTCTATAGCCC |
| IR (inverted repeat) | [9-14] [19-24] nt (CGCACC..GGTGCG) |
| Location of nic site | [32-33] nt |
| Conserved sequence flanking the nic site | TGTCT|ATAGC |
| Note | _ |
Visualization of oriT structure Reference| [1] Revilla C et al (2008) Different pathways to acquiring resistance genes illustrated by the recent evolution of IncW plasmids. Antimicrob Agents Chemother. 52(4):1472-80. [PMID:18268088] |
| ID | 212 |
| Plasmid name | pIE522 |
| GenBank accession number | EU247928.1 |
| Incompatibility group | IncW |
| Genome size | 38 kb |
| Coordinate of oriT [Strand] | _ |
| Drug resistance |  resistance to gentamicin, kanamycin, sulfonamide and tobramycin |
| Heavy-metal resistance | _ |
| Virulence factor | _ |
| Xenobiotic degradation | _ |
| Host bacterium [NCBI Taxonomy ID] | Klebsiella pneumoniae [573] |
Reference| [1] Revilla C et al (2008) Different pathways to acquiring resistance genes illustrated by the recent evolution of IncW plasmids. Antimicrob Agents Chemother. 52(4):1472-80. [PMID:18268088] |