 oriTDB accession number | 100203 |
| Name | oriT_pJHCMW1  |
Sequence Completeness  | intact |
| oriT length | 218 nt |
| oriT sequence | GATGGCATGGGGTGATATCCAGTAGCTAAGGGGTTGTTAGCGGGTTTCGGGGCGCAGCCC TGAATCAGTCATGTAACACTAGCAGAGTGTACACGGGCTAAATATGTTACGGAGGAGTAA CACTTCGCGAAAGTGCTTCATATGGCAGAGGGAAAATGCAGCGCTAGAGCGTACAGGAGA AAATAGAGGTTACGGTGATATGACGCTTCTTCGCTCAT |
| IR (inverted repeat) | [46-53] [57-64] nt (TTCGGGGC..GCCCTGAA) [76-80] [86-90] nt (ACACT..AGTGT) [106-110] [117-122] nt (GTTAC..GTAACA) |
| Location of nic site | [97-98] nt |
| Conserved sequence flanking the nic site | CGGG|CTAA |
| Note | _ |
Visualization of oriT structure Reference| [1] Dery KJ et al (1997) Characterization of the replication and mobilization regions of the multiresistance Klebsiella pneumoniae plasmid pJHCMW1. Plasmid. 38(2):97-105. [PMID:9339467] |
| [2] Sarno R et al (2002) Complete nucleotide sequence of Klebsiella pneumoniae multiresistance plasmid pJHCMW1. Antimicrob Agents Chemother. 46(11):3422-7. [PMID:12384346] |
| ID | 196 |
| Plasmid name | pJHCMW1 |
| GenBank accession number | NC_003486.1 |
| Genome size | 11354 bp |
| Coordinate of oriT [Strand] | 1883..2100 [-] |
| Drug resistance |  resistance to amikacin (aac(6 )-Ib), tobramycin (aac(6 )-Ib), kanamycin (aac(6 )-Ib); presence of aadA1 (aminoglycoside adenylyltransferase), blaOXA-9 (Beta-Lactam, bla OXA-9), and blaTEM-1 (beta-lactamase CTX-M-14) |
| Heavy-metal resistance | _ |
| Virulence factor | _ |
| Xenobiotic degradation | _ |
| Host bacterium [NCBI Taxonomy ID] | Klebsiella pneumoniae [573] |
Reference| [1] Dery KJ et al (1997) Characterization of the replication and mobilization regions of the multiresistance Klebsiella pneumoniae plasmid pJHCMW1. Plasmid. 38(2):97-105. [PMID:9339467] |
| [2] Sarno R et al (2002) Complete nucleotide sequence of Klebsiella pneumoniae multiresistance plasmid pJHCMW1. Antimicrob Agents Chemother. 46(11):3422-7. [PMID:12384346] |