GATGGCATGGGGTGATATCCAGTAGCTAAGGGGTTGTTAGCGGGTTTCGGGGCGCAGCCC
TGAATCAGTCATGTAACACTAGCAGAGTGTACACGGGCTAAATATGTTACGGAGGAGTAA
CACTTCGCGAAAGTGCTTCATATGGCAGAGGGAAAATGCAGCGCTAGAGCGTACAGGAGA
AAATAGAGGTTACGGTGATATGACGCTTCTTCGCTCAT
[1] Dery KJ et al (1997) Characterization of the replication and mobilization regions of the multiresistance Klebsiella pneumoniae plasmid pJHCMW1. Plasmid. 38(2):97-105. [PMID:9339467] |
[2] Sarno R et al (2002) Complete nucleotide sequence of Klebsiella pneumoniae multiresistance plasmid pJHCMW1. Antimicrob Agents Chemother. 46(11):3422-7. [PMID:12384346] |
![]() | 196 |
![]() | pJHCMW1 |
![]() | NC_003486.1 |
![]() | 11354 bp |
![]() | 1883..2100 [-] |
![]() | ![]() presence of aadA1 (aminoglycoside adenylyltransferase), blaOXA-9 (Beta-Lactam, bla OXA-9), and blaTEM-1 (beta-lactamase CTX-M-14) |
![]() | _ |
![]() | _ |
![]() | _ |
![]() | Klebsiella pneumoniae [573] |
[1] Dery KJ et al (1997) Characterization of the replication and mobilization regions of the multiresistance Klebsiella pneumoniae plasmid pJHCMW1. Plasmid. 38(2):97-105. [PMID:9339467] |
[2] Sarno R et al (2002) Complete nucleotide sequence of Klebsiella pneumoniae multiresistance plasmid pJHCMW1. Antimicrob Agents Chemother. 46(11):3422-7. [PMID:12384346] |