ACACCACCCAATTTTGGAGTGGTGTGTAAGTGCGCATT
[1] Dougherty BA et al (1998) Sequence and analysis of the 60 kb conjugative, bacteriocin-producing plasmid pMRC01 from Lactococcus lactis DPC3147. Mol Microbiol. 29(4):1029-38. [PMID:9767571] |
[2] Parker C et al (2005) Elements in the co-evolution of relaxases and their origins of transfer. Plasmid . 53(2):113-8. [PMID:15737398] |
[3] Hickey RM et al (2001) Exploitation of plasmid pMRC01 to direct transfer of mobilizable plasmids into commercial lactococcal starter strains. Appl Environ Microbiol. 67(6):2853-8. [PMID:11375207] |
[4] Becker EC et al (2003) Relaxed specificity of the R1162 nickase: a model for evolution of a system for conjugative mobilization of plasmids. J Bacteriol. 185(12):3538-46. [PMID:12775691] |