TGAATGTTACCACCGGTAACATGTAAGTGCGCCCT
[1] Park MS et al (1999) Sequence analysis of plasmid pKJ50 from Bifidobacterium longum. Microbiology. 145 ( Pt 3):585-92. [PMID:10217492] |
[2] Parker C et al (2005) Elements in the co-evolution of relaxases and their origins of transfer. Plasmid . 53(2):113-8. [PMID:15737398] |
[3] Becker EC et al (2003) Relaxed specificity of the R1162 nickase: a model for evolution of a system for conjugative mobilization of plasmids. J Bacteriol. 185(12):3538-46. [PMID:12775691] |