GCACGGGTAATCTCGAAGAGATTACTCTAAGTGCGCCCTTGC
[1] Drolet M et al (1992) Mobilization protein-DNA binding and divergent transcription at the transfer origin of the Thiobacillus ferrooxidans pTF1 plasmid. Mol Microbiol. 6(8):1061-71. [PMID:1584023] |
[2] Cook DM et al (1992) The oriT region of the Agrobacterium tumefaciens Ti plasmid pTiC58 shares DNA sequence identity with the transfer origins of RSF1010 and RK2/RP4 and with T-region borders. J Bacteriol. 174(19):6238-46. [PMID:1400174] |
[3] Parker C et al (2005) Elements in the co-evolution of relaxases and their origins of transfer. Plasmid . 53(2):113-8. [PMID:15737398] |