 oriTDB accession number | 100166 |
| Name | oriT_oriT_pKL1  |
Sequence Completeness  | intact |
| oriT length | 100 nt |
| oriT sequence | CGGGGTGTCGGGGTGAAGCCCTGACCAAGTGGTAATCGTATCGGCGTGCATGCGCGGTTA TACGATTACACATCCTGTCCCGATTTCTGAGGCGTTTTAA |
| IR (inverted repeat) | [7-15] [17-25] nt (GTCGGGGGT..AGCCCTGAC) [32-50] [51-69] nt (GTAATCGTATCGGCGTGCA..TGCGCGGTTATACGATTAC) |
| Location of nic site | [77-78] nt |
| Conserved sequence flanking the nic site | CATCCTG|T |
| Note | _ |
Visualization of oriT structure (The oriT was characterized experimentally) Reference| [1] Srivastava P et al (2006) Characterization of broad host range cryptic plasmid pCR1 from Corynebacterium renale. Plasmid. 56(1):24-34. [PMID:16545871] |
| [2] Burian et al (1999) Replication Control of a Small Cryptic Plasmid of Escherichia coli. J Mol Biol. 294(1):49-65. [PMID:10556028] |
| ID | 160 |
| Plasmid name | pKL1 |
| GenBank accession number | NC_002145.1 |
| Genome size | 1549 bp |
| Coordinate of oriT [Strand] | 334..400 [+] |
| Drug resistance | _ |
| Heavy-metal resistance | _ |
| Virulence factor | _ |
| Xenobiotic degradation | _ |
| Host bacterium [NCBI Taxonomy ID] | Escherichia coli [562] |
Reference