 oriTDB accession number | 100126 |
| Name | oriT_pREN  |
Sequence Completeness  | intact |
| oriT length | 95 nt |
| oriT sequence | AAAAGCCGATTTGCGAACAGCAAACTTTCGGCTTTTTTTGTGCGGTTTTTTTGTGTCCTT TTTTTGCAAAAAAAGGGCAGGTTTTCGGGTTTGAA |
| IR (inverted repeat) | IR1: [1-9] [28-36] nt (AAAAGCCGA..TCGGCTTTT) IR2: [54-66] [67-79] nt (TGTCCTTTTTTTG..CAAAAAAAGGGCA) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site | _ |
| Note | almost identical to that of the pLJ42 plasmid (100% query coverage with 97% identity) |
Visualization of oriT structure Reference| [1] Asteri IA et al (2011) Comparative and evolutionary analysis of plasmid pREN isolated from Lactobacillus rennini, a novel member of the theta-replicating pUCL287 family. FEMS Microbiol Lett. 318(1):18-26. [PMID:21291494] |
| ID | 121 |
| Plasmid name | pREN |
| GenBank accession number | NC_019233.1 |
| Genome size | 4371 bp |
| Coordinate of oriT [Strand] | |
| Drug resistance | _ |
| Heavy-metal resistance | _ |
| Virulence factor | _ |
| Xenobiotic degradation | _ |
| Host bacterium [NCBI Taxonomy ID] | Lactobacillus rennini ACA-DC 1534 [238013] |
Reference