 oriTDB accession number | 100122 |
| Name | oriT_pHE1  |
Sequence Completeness  | incomplete |
| oriT length | 22 nt |
| oriT sequence | GCCCTCTGTGTATAATGGCTTA |
| IR (inverted repeat) | _ |
| Location of nic site | [18-19] nt |
| Conserved sequence flanking the nic site | ATGG|CTTA |
| Note | ColE1 superfamily |
Visualization of oriT structure Reference| [1] Vargas C et al (1999) Genetic organization of the mobilization region of the plasmid pHE1 from Halomonas elongata. Syst Appl Microbiol. 22(4):520-9. [PMID:10794139] |
| ID | 117 |
| Plasmid name | pHE1 |
| GenBank accession number | _ |
| Genome size | 4.2 kb |
| Coordinate of oriT [Strand] | _ |
| Drug resistance | _ |
| Heavy-metal resistance | _ |
| Virulence factor | _ |
| Xenobiotic degradation | _ |
| Host bacterium [NCBI Taxonomy ID] | Halomonas elongata ATCC 33174 [2746] |
Reference