GGGCGCACGTTTCTGAACGAAGTGAAGAAAGTCTAAGTGCGCCCT
[1] Meyer R (2000) Identification of the mob genes of plasmid pSC101 and characterization of a hybrid pSC101-R1162 system for conjugal mobilization. J Bacteriol. 182(17):4875-81. [PMID:10940031] |
[2] Jandle S et al (2006) Stringent and relaxed recognition of oriT by related systems for plasmid mobilization: implications for horizontal gene transfer. J Bacteriol. 188(2):499-506. [PMID:16385040] |
[3] Parker C et al (2005) Elements in the co-evolution of relaxases and their origins of transfer. Plasmid . 53(2):113-8. [PMID:15737398] |