 oriTDB accession number | 100108 |
| Name | oriT_pRmeGR4a  |
Sequence Completeness  | core |
| oriT length | 59 nt |
| oriT sequence | GCAGGAAAACGGCGTAGCACATTTTTCCGTATCCTGCCCCTCCACATTGTAAGGGGATT |
| IR (inverted repeat) | [4-14] [18-28] nt (GGAAAACGGCG..CACATTTTTCC) |
| Location of nic site | [36-37] nt |
| Conserved sequence flanking the nic site | TATCCTG|C |
| Note | P-type plasmid oriTs |
Visualization of oriT structure (The oriT was characterized experimentally) Reference| [1] Herrera-Cervera JA et al (1998) Cloning and identification of conjugative transfer origins in the Rhizobium meliloti genome. J Bacteriol. 180(17):4583-90. [PMID:9721299] |
| ID | 103 |
| Plasmid name | pRmeGR4a |
| GenBank accession number | NC_019846.2 |
| Genome size | 175983 bp |
| Coordinate of oriT [Strand] | 79155..79213 [-] |
| Drug resistance | _ |
| Heavy-metal resistance | _ |
| Virulence factor | _ |
| Xenobiotic degradation | _ |
| Host bacterium [NCBI Taxonomy ID] | Sinorhizobium meliloti GR4 [1235461] |
Reference