 oriTDB accession number | 100089 |
| Name | oriT_pAST4  |
Sequence Completeness  | core |
| oriT length | 35 nt |
| oriT sequence | CCAGAAGAATTCTGGTATACCGTGTTATACCAAAT |
| IR (inverted repeat) | [1-6] [10-15] nt (CCAGAA..TTCTGG) |
| Location of nic site | [24-25] nt |
| Conserved sequence flanking the nic site | TACCGTG|TTAT |
| Note | _ |
Visualization of oriT structure Reference| [1] Alippi AM et al (2014) Tetracycline-resistance encoding plasmids from Paenibacillus larvae, the causal agent of American foulbrood disease, isolated from commercial honeys. Int Microbiol. 17(1):49-61. [PMID:25296446] |
| ID | 84 |
| Plasmid name | pAST4 |
| GenBank accession number | NC_025099.1 |
| Genome size | 5031 bp |
| Coordinate of oriT [Strand] | 2926..2960 [+] |
| Drug resistance | resistance to tetracycline |
| Heavy-metal resistance | _ |
| Virulence factor | _ |
| Xenobiotic degradation | _ |
| Host bacterium [NCBI Taxonomy ID] | Uncultured bacterium AST4 [1328263] |
Reference| [1] Alippi AM et al (2014) Tetracycline-resistance encoding plasmids from Paenibacillus larvae, the causal agent of American foulbrood disease, isolated from commercial honeys. Int Microbiol. 17(1):49-61. [PMID:25296446] |