 oriTDB accession number | 100068 |
| Name | oriT_pPAB19-3  |
Sequence Completeness  | intact |
| oriT length | 175 nt |
| oriT sequence | GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTGAC TATGTTGGCACGGATGTGGAAATCAGTGAAGTGCTTCATGTAGCAGGAGAAAAAAGGCGG CACCAGCGCGTCAGCAGGATATGTAGTACAGGATATATTCCGCTTCCTCGCTCAC |
| IR (inverted repeat) | IR1: [2-11] [15-24] nt (GTTTCGGGGC..GCCCTGAACC) IR2: [92-98] [99-105] nt (TGCTTCA..TGTAGCA) |
| Location of nic site | [55-56] nt |
| Conserved sequence flanking the nic site | CTGG|CTGA |
| Note | ColE1 superfamily |
Visualization of oriT structure Reference| [1] Tran T et al (2012) Small plasmids harboring qnrB19: a model for plasmid evolution mediated by site-specific recombination at oriT and Xer sites. Antimicrob Agents Chemother. 56(4):1821-7. [PMID:22290975] |
| ID | 64 |
| Plasmid name | pPAB19-3 |
| GenBank accession number | NC_019085.1 |
| Genome size | 2989 bp |
| Coordinate of oriT [Strand] | 677..851 [-] |
| Drug resistance | qnrB19 gene (resistance to quinolones) |
| Heavy-metal resistance | _ |
| Virulence factor | _ |
| Xenobiotic degradation | _ |
| Host bacterium [NCBI Taxonomy ID] | Escherichia coli M9888 [562] |
Reference| [1] Tran T et al (2012) Small plasmids harboring qnrB19: a model for plasmid evolution mediated by site-specific recombination at oriT and Xer sites. Antimicrob Agents Chemother. 56(4):1821-7. [PMID:22290975] |