 oriTDB accession number | 100057 |
| Name | oriT1_pSBardo-Kan  |
Sequence Completeness  | core |
| oriT length | 58 nt |
| oriT sequence | GTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA |
| IR (inverted repeat) | [1-10] [14-23] nt (GTGTCGGGGC..GCCATGACCC) |
| Location of nic site | [54-55] nt |
| Conserved sequence flanking the nic site | CTGG|CTTA |
| Note | ColE1 superfamily |
Visualization of oriT structure Reference| [1] Chen CY et al (2011) Sequence analysis of a group of low molecular-weight plasmids carrying multiple IS903 elements flanking a kanamycin resistance aph gene in Salmonella enterica serovars. Plasmid. 65(3):246-52. [PMID:21324339] |
| ID | 55 |
| Plasmid name | pSBardo-Kan |
| GenBank accession number | NC_015575.1 |
| Genome size | 8198 bp |
| Coordinate of oriT [Strand] | 936..993 [-]; 1522..1790 [-] |
| Drug resistance | kanamycin resistance |
| Heavy-metal resistance | _ |
| Virulence factor | _ |
| Xenobiotic degradation | _ |
| Host bacterium [NCBI Taxonomy ID] | Salmonella enterica serovar Bardo strain ARS 886 [932733] |
Reference| [1] Chen CY et al (2011) Sequence analysis of a group of low molecular-weight plasmids carrying multiple IS903 elements flanking a kanamycin resistance aph gene in Salmonella enterica serovars. Plasmid. 65(3):246-52. [PMID:21324339] |