 oriTDB accession number | 100046 |
| Name | oriT_pTiR10  |
Sequence Completeness  | core |
| oriT length | 37 nt |
| oriT sequence | CCAAGGGCGCAATTATACGTCGTGATACGACGCGTTG |
| IR (inverted repeat) | [18-23] [27-32] nt (CGTCGT..ACGACG) |
| Location of nic site | [7-8] nt |
| Conserved sequence flanking the nic site | _ |
| Note | Ti plasmid |
Visualization of oriT structure Reference| [1] Wetzel ME et al (2014) Quorum-dependent mannopine-inducible conjugative transfer of an Agrobacterium opine-catabolic plasmid. J Bacteriol. 196(5):1031-44. [PMID:24363349] |
| [2] Cho H et al (2007) TraA, TraC and TraD autorepress two divergent quorum-regulated promoters near the transfer origin of the Ti plasmid of Agrobacterium tumefaciens. Mol Microbiol. 63(6):1769-82. [PMID:17367394] |
| ID | 44 |
| Plasmid name | pTiR10 |
| GenBank accession number | _ |
| Genome size | _ |
| Coordinate of oriT [Strand] | _ |
| Drug resistance | _ |
| Heavy-metal resistance | _ |
| Virulence factor | _ |
| Xenobiotic degradation | _ |
| Host bacterium [NCBI Taxonomy ID] | Agrobacterium tumefaciens [358] |
Reference