 oriTDB accession number | 100011 |
| Name | oriT_pPS12-1  |
Sequence Completeness  | incomplete |
| oriT length | 67 nt |
| oriT sequence | GCCCGTTGAGTGCCGCAGGCGCGAATAAGGGACAGCGAAGATAGATAACCGGCCCGCCGG TTAGCTA |
| IR (inverted repeat) | [49-53] [56-60] nt (CCGGC..GCCGG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site | _ |
| Note | _ |
Visualization of oriT structure Reference| [1] Beil S et al (1999) Genetic and biochemical analyses of the tec operon suggest a route for evolution of chlorobenzene degradation genes. J Bacteriol. 181(1):341-6. [PMID:9864349] |
| ID | 10 |
| Plasmid name | pPS12-1 |
| GenBank accession number | AF073903.1 |
| Incompatibility group | IncP1 |
| Genome size | < 50 kb |
| Coordinate of oriT [Strand] | _ |
| Drug resistance | _ |
| Heavy-metal resistance | _ |
| Virulence factor | _ |
| Xenobiotic degradation | degradation of tetrachlorobenzene |
| Host bacterium [NCBI Taxonomy ID] | Burkholderia sp. PS12 [36773] |
Reference| [1] Beil S et al (1999) Genetic and biochemical analyses of the tec operon suggest a route for evolution of chlorobenzene degradation genes. J Bacteriol. 181(1):341-6. [PMID:9864349] |