CCAGTTTCTCGAAGAGAAACCGGTAAGTGCGCCCTCCC
[1] Meyer R (2009) Replication and conjugative mobilization of broad host-range IncQ plasmids. Plasmid. 62(2):57-70. [PMID:19465049] |
[2] Cook DM et al (1992) The oriT region of the Agrobacterium tumefaciens Ti plasmid pTiC58 shares DNA sequence identity with the transfer origins of RSF1010 and RK2/RP4 and with T-region borders. J Bacteriol. 174(19):6238-46. [PMID:1400174] |
[3] Scherzinger E et al (1993) Purification of the large mobilization protein of plasmid RSF1010 and characterization of its site-specific DNA-cleaving/DNA-joining activity. Eur J Biochem. 217(3):929-38. [PMID:8223650] |