Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | sprG-sprF/- |
| Location | 1209728..1209925 | Replicon | chromosome |
| Accession | NZ_CP026071 | ||
| Organism | Staphylococcus aureus strain FDAARGOS_30 | ||
Toxin (Protein)
| Gene name | SprG2 | Uniprot ID | - |
| Locus tag | RK88_RS06395 | Protein ID | WP_000623369.1 |
| Coordinates | 1209818..1209925 (-) | Length | 36 a.a. |
Antitoxin (RNA)
| Gene name | SprF3 | ||
| Locus tag | - | ||
| Coordinates | 1209728..1209765 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| RK88_RS06360 | 1204921..1205208 | - | 288 | WP_000410718.1 | hypothetical protein | - |
| RK88_RS06365 | 1205549..1205839 | + | 291 | WP_001791476.1 | hypothetical protein | - |
| RK88_RS06370 | 1205927..1206568 | - | 642 | Protein_1174 | ABC transporter ATP-binding protein | - |
| RK88_RS06375 | 1206565..1206885 | - | 321 | WP_000873929.1 | YxeA family protein | - |
| RK88_RS06380 | 1206888..1208852 | - | 1965 | WP_000870819.1 | bacteriocin-associated integral membrane family protein | - |
| RK88_RS06385 | 1208896..1209168 | - | 273 | WP_001794574.1 | lactococcin 972 family bacteriocin | - |
| RK88_RS06390 | 1209178..1209279 | - | 102 | WP_001790623.1 | hypothetical protein | - |
| - | 1209728..1209765 | + | 38 | - | - | Antitoxin |
| RK88_RS06395 | 1209818..1209925 | - | 108 | WP_000623369.1 | putative holin-like toxin | Toxin |
| RK88_RS06400 | 1210196..1210798 | - | 603 | WP_001033867.1 | CPBP family intramembrane metalloprotease | - |
| RK88_RS06405 | 1210813..1210989 | - | 177 | WP_000214898.1 | YkvS family protein | - |
| RK88_RS06410 | 1211188..1212174 | + | 987 | WP_000668820.1 | lipoate--protein ligase | - |
| RK88_RS06415 | 1212255..1212473 | - | 219 | WP_000876825.1 | IDEAL domain-containing protein | - |
| RK88_RS06420 | 1212683..1213252 | + | 570 | WP_000287265.1 | competence protein ComK | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 36 a.a. Molecular weight: 3801.69 Da Isoelectric Point: 10.8004
>T93103 WP_000623369.1 NZ_CP026071:c1209925-1209818 [Staphylococcus aureus]
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
VISIANALHLMLSFGMFIVTFIGVVVAIINLNNKK
Download Length: 108 bp
>T93103 NZ_CP026071:c1209925-1209818 [Staphylococcus aureus]
GTGATATCTATTGCAAACGCATTACATTTAATGTTAAGTTTCGGTATGTTTATCGTCACTTTCATTGGTGTAGTAGTCGC
AATAATTAATTTAAACAATAAAAAATAA
GTGATATCTATTGCAAACGCATTACATTTAATGTTAAGTTTCGGTATGTTTATCGTCACTTTCATTGGTGTAGTAGTCGC
AATAATTAATTTAAACAATAAAAAATAA
Antitoxin
Download Length: 38 bp
>AT93103 NZ_CP026071:1209728-1209765 [Staphylococcus aureus]
AACATGTCGCCTAATGAGCCCGTTAAAAAGACGGTGAC
AACATGTCGCCTAATGAGCCCGTTAAAAAGACGGTGAC
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|